Gene ID10043
Gene NameHAH_2171
AnnotationMet tRNA
LocationI:2099972→2100009
Gene typetRNA
GC content0.662162162162162
DNA (38 bp, Edit)GCCCGGGTGGCTTAGCTGGACATAGCGCCGCACTCATAATGCGGAGATCGAGGGTTCGGAGCCCTCCCCGGGCA