Gene ID1857
Gene Namecdc6e
Annotationcell division control protein 6
LocationI:1801058←1802386
Gene typeFunctional gene
GC content59
Hydropathicity-0.479185520361991
DNA (1329 bp, Edit)ATGGTCGACGTGAACGAGAACCCGTTCGATGGGACTGACGCGATCTTCGAACGAAAGCAACCGCTGAAAAAAGACACGTTCACGCCGGATACGATCTTTCACCGCGACGAGGAGATCGAGTTCTACATCAACGCGCTTCAGGACGTCATCGTCGGCCACGACCCCAACAACGTCTTCGTCTACGGCCCAACGGGGGTCGGAAAGACTGCCGTTACGAAGTGGGTACGGGACAAACTCGAAGAGAAGGCCGAGGCCGAGGACATCCCACTCACCGTTGTCGGTCCGATAAACTGCCGGAACTACCGGTCGGCGTACGCCCTGGTCAACACACTCGTCAACGAGTTCCGAGATCCGGAGAACCAACTCCCCGAGAGCGGCTACAGCACTGACAGCGTCTTCGAGTTCCTCTACGAGGAGATCGAAGCCGTGGGTGGGAACGTCCTCATCATCCTGGACGAGATCGACAACATTCCAGCGGACGCGCGGAACGACTTCCTGTATGAACTGCCGCGGGCCGAAGCGAACGAGAACACGCCGATCACCGATGCGAAGGTCGGACTCATCGGGATTTCGAACGACCTCAAGTTCGTCGACGTGCTGGAACCCAAAGTGAAATCGACGCTCGGGGAGCGAGAGATCAAGTTCGGTCCGTACGACGCAACGGAACTCCGAGACATTCTCGGCTACTACGCCGACATTGCGTTCCGAGAGGACGTGCTCGGCGAAGATGTCGTCCCGCTGGCGGCGGCCTTCTCGGCGCAGGAACGGGGCGACGTTCGGCAGGGACTCCGAATCCTCGAAAAGGCCGGAGAGTACGCGCGGATGGAGGGCGCGGACGGTGTGACAGAAGCACATACGCGACGGGCGACAGACACTATCGAAACCGACGAACTGCTGGATTACTTCGAGCACGACCTGAGTTCACAGCAGGCGCTGACGTACCTCGCGACGACGCTTGCGCTCATCGAACCGAAACACGAGGCGTCGACAAAGCGGATTTACAACCTCTACTCCTCGATTGCGGAGTCGAGTGGCCGCCGCGTGAAATCCGAACGCAAGATCTACGAGTTCCTCGACCAGCTTTCCATGCAAGGGCTAGTCCGCTCGGCCGAACGCAACCTCGGTCGCAAGGGTGGGCGCAAGTACATCTACGAGGTCACCGACGACGCGACCGATATCATCAACGCCGCGCTCCAGTCGTCCTACAGCGATGCCGTGCCGAGCAACGTCAACGGGATACTCGAACACTATCTGGAAGACGAGGCCACCGAGTTTGAGGCACCGGACACGACCGACGACGAGCAACAGAACCTCTGGCAGTTCACGTAG
pI4.1579
MW (k)49760.1
Translation (441 aa, Edit)MVDVNENPFDGTDAIFERKQPLKKDTFTPDTIFHRDEEIEFYINALQDVIVGHDPNNVFVYGPTGVGKTAVTKWVRDKLEEKAEAEDIPLTVVGPINCRNYRSAYALVNTLVNEFRDPENQLPESGYSTDSVFEFLYEEIEAVGGNVLIILDEIDNIPADARNDFLYELPRAEANENTPITDAKVGLIGISNDLKFVDVLEPKVKSTLGEREIKFGPYDATELRDILGYYADIAFREDVLGEDVVPLAAAFSAQERGDVRQGLRILEKAGEYARMEGADGVTEAHTRRATDTIETDELLDYFEHDLSSQQALTYLATTLALIEPKHEASTKRIYNLYSSIAESSGRRVKSERKIYEFLDQLSMQGLVRSAERNLGRKGGRKYIYEVTDDATDIINAALQSSYSDAVPSNVNGILEHYLEDEATEFEAPDTTDDEQQNLWQFT