Gene ID1623
Gene NamefolD1
Annotationmethylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
LocationI:1558974←1559867
Gene typeFunctional gene
GC content65
Hydropathicity-0.163299663299663
DNA (894 bp, Edit)ATGACAGAGATTATCGACGGCGACGCCGTCGCACAGTCGATTCGGGATGACCTGGTCGCGTCCATCGACCACCTCGCCGACGCGGGCGAGCGCCCGTCGCTGGCGACGGTCCTGATGTCCGAGGACCCGGCCAGCGAGACCTACGTCTCGATGAAACAGAACGACTGCGAGGAGGTCGGTATCGAGGCAATCGACATCGACATCGACCCCGACGCGGACGCTGCCGAACTGTACGACACTATCGAGGACCTCAACGCCGACGACGACGTCAACGGCATCCTGGTCCAGATGCCGGTCCCCGACCACGTCGAGGACAGGTCGGTCCTGCGAGCCATCGACCCGATGAAAGACGTCGACGGCTTCCATCCGGAGAACGTCGGCCGACTCGTCGCCGGTGACGCCCGCTACAAGCCCTGCACACCCCACGGCATCCAGAAGCTCATCGAGAGCGTGGGTGTGGACACAGAAGGCAAAGACGCCGTCGTCGTCGGCCGGTCGGACATCGTCGGCAAACCGATGGCGAACCTGCTCATCCAGAAGGCACCGGGCGGCAACGCGACGACGACGGTGTGTCACTCCCGCACCGAGAACCTCGCCGAACGGACGCGCAACGCCGACATCCTCGTCGCCGCGGCTGGCGTCCCGGAGATGATCGACGGCGAGATGATCGGAGAGGGCGCGACGGTCATCGACGTGGGCATCAACCGCGTCGACGCTGACACCGAGAAGGGCTACGAACTCGTCGGCGACGTGGAGTACGAGAGCGCAAAGGAGGTCGCTGGCGCAATCACGCCGGTCCCCGGCGGCGTCGGTCCGATGACTCGCGCGATGTTGCTGTACAATACGGTCAAAGCGACGGGCCTGCAACACGACATCGACGTCGACCTGCCCTGA
pI3.9418
MW (k)31496.2
Translation (296 aa, Edit)MTEIIDGDAVAQSIRDDLVASIDHLADAGERPSLATVLMSEDPASETYVSMKQNDCEEVGIEAIDIDIDPDADAAELYDTIEDLNADDDVNGILVQMPVPDHVEDRSVLRAIDPMKDVDGFHPENVGRLVAGDARYKPCTPHGIQKLIESVGVDTEGKDAVVVGRSDIVGKPMANLLIQKAPGGNATTTVCHSRTENLAERTRNADILVAAAGVPEMIDGEMIGEGATVIDVGINRVDADTEKGYELVGDVEYESAKEVAGAITPVPGGVGPMTRAMLLYNTVKATGLQHDIDVDLP