Gene ID1609
Gene NamessuE2
AnnotationNADPH-dependent FMN reductase
LocationI:1545952←1546530
Gene typeFunctional gene
GC content61
Hydropathicity-0.0489583333333334
DNA (579 bp, Edit)ATGTCCGAACCACACATCGTCGGTGTCGTCGGCAGTCTCAGAGAGGAGAGCTACACCAGGGTCGGTATCGAGCGCGCGCTCGTCGCCGCCGAGGAGTTGGGGGCGACCACGGAACTGCTGGATCTTCAGGAATTCGACCTACCGGTGTTCGATGCCGACCATCGCGAGGTCGGCGACGCTGTCGAGTTCGCCGATAGAGTTCACGCGGCTGATTCAATTCTGCTGGGGACGCCGGTGTATCACGGGTCCTATTCCGGCATGCTGAAGAACGCACTCGACTACTGTGGCTTCGACGAGTTCGAACACAAAACCGTGGGATTGCTAGCGGTCGCCGGCGGGGGCTTTCCCATCACCGCGCTCGAACACCTCCGCTCGGTCTGCCGGGCGCTGAACTGCTGGGTCATCCCGCATCAGGCCGCGGTTCCGAACGCACACAATCACATCGCTGACGGTCAGATAGTCGACGCCGATATCGAGGAACGCGTGACGTCGCTCGGTGAGGAAGCAGTCAAGTACGCGAACATCGAGCCGGACTCGGCGTGTTTCGAGAGTACGGAGAACGTCGGAGCGGACGATTAG
pI4.1501
MW (k)20704
Translation (191 aa, Edit)MSEPHIVGVVGSLREESYTRVGIERALVAAEELGATTELLDLQEFDLPVFDADHREVGDAVEFADRVHAADSILLGTPVYHGSYSGMLKNALDYCGFDEFEHKTVGLLAVAGGGFPITALEHLRSVCRALNCWVIPHQAAVPNAHNHIADGQIVDADIEERVTSLGEEAVKYANIEPDSACFESTENVGADD