Gene ID1196
Gene NameHAH_1196
Annotationmetallopeptidase
LocationI:1130954←1131628
Gene typeFunctional gene
GC content67
Hydropathicity0.853125
DNA (675 bp, Edit)ATGGCGGGTCGACGACAGCGAACCGCTGGAGGCCGGACCGTCGGCGGCCTCAGTTTCAGCCAGCGCGAACTCCGGGACCTCCTCGTCGCCTGGCTCGCACTCGGACTGGCGTTTACGTTCTTCCTCGAACGAGAGTTCCGCCGCATCGTCTTCGGCCAGTTCGGCGGGCTGTCGACGGCCGAAATCGCCAGCACGTTCGCCGTCAGCCTGCTGACCGTCGGCGTCGGCTTCCTGTTGCACGAACTGGCCCACAAGGTCGTCGCCGTCCGCTTCGGTCAGATCGCCGCGTTCAAGGCCGACTACCGGATGCTCGGGTTCGCAGTCCTGGGCGGCCTCGTCGGCTTCCTGTTCGCCGCGCCGGGCGCGGTCGTTCATCGTGGCCGTCTCACGGCGAAGCAACACGGCCTCATCGCCGTCGCCGGACCGGTAACGAACCTCGCGCTCGCCGTCGTGTTCCTCGTGCCGTTCGTCGCGGCGCTCCTGTCGAGTACGGGCGGCTTCCTCTGGGAGGTCGCGCGGATGGGCCTGCAGATCAATCTCCTGCTCGCCGGCTTCAACATGCTGCCGTTCGGTCCGCTCGACGGCCGAACGGTCCGGGAATGGAGCACACCGGTGTTTCTCGCCGTGGCGGTTCCGTCGATTCTGCTCGGAGTCGGCGCGCTGTTCGTTCTCTGA
pI12.0474
MW (k)23825.3
Translation (223 aa, Edit)MAGRRQRTAGGRTVGGLSFSQRELRDLLVAWLALGLAFTFFLEREFRRIVFGQFGGLSTAEIASTFAVSLLTVGVGFLLHELAHKVVAVRFGQIAAFKADYRMLGFAVLGGLVGFLFAAPGAVVHRGRLTAKQHGLIAVAGPVTNLALAVVFLVPFVAALLSSTGGFLWEVARMGLQINLLLAGFNMLPFGPLDGRTVREWSTPVFLAVAVPSILLGVGALFVL