Gene ID1190
Gene NamepsmA1
Annotationproteasome subunit alpha
LocationI:1127339←1128052
Gene typeFunctional gene
GC content65
Hydropathicity-0.268354430379747
DNA (714 bp, Edit)ATGACTCCGGGGCCGGAGCTTTCTGGACCCCAGGCTGCTGACGAGTTCCAGAGCGACCCGTACGCGCCCGAAGTCGGCGAGCTCCCCGAACAGTCCGCACAGGATTCGGAGAAGGTGAACAAGACCGGGACGACCACCATCGGCATCAGCACGTCCGAGGGCGTCGTCATCGCGACTGACATGCGCGCCTCGCTCGGTGGTCGCTTCGTCTCGAACAAGAACGTCCAGAAGGTCGAGCAGATTCACCCCACGGCGGCGCTGACCCTCGTCGGGAGCGTCGGCGGCGCACAGTCGTTCATCCGGACGCTTCGCGCCGAGGTCAACCTCTACGAAGCACGACGCGGCGAGGACATCAGCATGAAGGCCCTCTCGACGCTGGCCGGCAACTTCGCCCGCGGCGGCCCCTTCTTCGCCATCAACCCTATCCTCGGTGGCGTCGACGACGACGGCCACCACGTCTACTCCATCGACCCGGCCGGCGGCGTCATGAAGGACGACTACACCGTCACCGGCTCCGGGCTCACCGTCGCGTACGGGACCCTCGAAGACCGCTACGAGGAAGACATGACCAACGAAGCGGCCAAGGAAGTCGCTGCCGCCTCGATTAACGCCGCCGCCGAGCGTGACACCGGGTCCGGCAACGGCATCTTCCTGGCTGATGTCACGAGCGAGGGTGTCGACATCAACGGCTACGACTTCGACGAACTGCTGTAG
pI4.0386
MW (k)24827.3
Translation (236 aa, Edit)MTPGPELSGPQAADEFQSDPYAPEVGELPEQSAQDSEKVNKTGTTTIGISTSEGVVIATDMRASLGGRFVSNKNVQKVEQIHPTAALTLVGSVGGAQSFIRTLRAEVNLYEARRGEDISMKALSTLAGNFARGGPFFAINPILGGVDDDGHHVYSIDPAGGVMKDDYTVTGSGLTVAYGTLEDRYEEDMTNEAAKEVAAASINAAAERDTGSGNGIFLADVTSEGVDINGYDFDELL