Gene ID1186
Gene Nameudp2
Annotationuridine phosphorylase
LocationI:1123653←1124477
Gene typeFunctional gene
GC content67
Hydropathicity-0.229562043795621
DNA (825 bp, Edit)ATGACAAGCGATAGTGAAGACCCGAACGACGACGTACAGTACCATCTGGAAGTGAGCGAGGCCGACGTGGCCGACAGCGTCCTGCTGCCGGGGAACCCGGAACGCGTCGAAAAGGTCGTCGACTACTGGGACGACCACGACATCGTCGCCGAGCACCGCGAGTACCGCACGGCAACGGGCACTCACGACGGCACGCCCATCTCTGTGACCTCGACGGGTATCGGCGGCCCGTCGGCCGCAATCGCGCTCGAAGAACTGGCCCGCGTCGGCGCTGACTCGTTCATCCGGGTCGGGTCCTGTGGCGCAATTCAGGAGGAAGCCAGTATCGGCGACCTCGTCATCACGACTGGCGCAGTACGGCAGGAGGGGACCAGCAAGGAGTACGTCCGCGAGGACTACCCCGCCAGCGCCGACCACCGGATCGTTTCGGCACTCGTCGCCGCCGCCGAGGAACTCGGCTACGACTACCACCTCGGCGTCACCTGCTCGACGGATAGTTTCTACGCCGGGCAGTCACGCCCGGGGTTCGAGGACTTCGAGGCCAGCGGCAGCGACGAACGCATCGCGGCGCTTCAAGAGGCCGGCGTCCTCAACTTCGAGATGGAGGCCGCGACGATTCTCACGCTCGCGAACCTGTACGGCCTGCGGGCCGGCGCTGTCTGTACGGTGTACGCCAACCGCGTCACCGGCGAGTTCCGAACCGAAGGCGAGCGCAAGGCAGCGAAATGCGCCAGCCTCGCCGTCTCCTATCTCGCCGAGATGGACGCGGCCGTCGAGGAGGCCGACGCCGACGGGTGGCACGCCGGCCTCTCTATCGACCGCTAG
pI4.0356
MW (k)29206.9
Translation (273 aa, Edit)MTSDSEDPNDDVQYHLEVSEADVADSVLLPGNPERVEKVVDYWDDHDIVAEHREYRTATGTHDGTPISVTSTGIGGPSAAIALEELARVGADSFIRVGSCGAIQEEASIGDLVITTGAVRQEGTSKEYVREDYPASADHRIVSALVAAAEELGYDYHLGVTCSTDSFYAGQSRPGFEDFEASGSDERIAALQEAGVLNFEMEAATILTLANLYGLRAGAVCTVYANRVTGEFRTEGERKAAKCASLAVSYLAEMDAAVEEADADGWHAGLSIDR