Gene ID1179
Gene NamegyrB
AnnotationDNA gyrase subunit B
LocationI:1113965→1115893
Gene typeFunctional gene
GC content61
Hydropathicity-0.523052959501556
DNA (1929 bp, Edit)ATGTCAGGAGAGTCTGATGAGTACGGCGCAAAGTCGATCCAGACCCTCGAAGGGCTGGAAGCCGTCCAGAAGCGACCCGCGATGTATATCGGGTCGACGGACGCTCGCGGCCTCCATCATCTCGTCTACGAGGTGGTCGACAACGCGATCGACGAGGCGCTCGCCGGCTACTGTGACAACATCGACGTAACGATTCACGACGACGGCTCCGTCTCTGTCAGCGACGATGGACGGGGCATCCCCGTCGATACCCACGAAGAGCACGGCCGCCCGGCCGTGGAGGTCGTGATGACGATTCTCCACGCCGGTGGGAAGTTCGACAACAAGTCCTACCAGGTCTCCGGTGGCCTCCACGGGGTCGGGGTGAGCGTGGTCAACGCACTCTCGAAGTGGCTCGAAGTCGAGGTCAGGCGCGACGGCGCGCTCTGGAAGCAGCGCTTCGACCACGGCAAACCGGAGTACGACCTCAAGAAGGTCCGCGACCTCGAACCCGACGAGGAGACGGGCACGACGGTCCGGTTCTGGCCGGATGACGAGATCTTCGAGACCGGCGAGTTCAAGTTCTCGACGCTGTCGTCCCGACTGCGGGAACTCGCCTTCCTCAACTCCGGTGTCGCCATCTCTATCATCGACGAGCGCGACGGCGAAACGGAGACGTTTGCCTACGACGGTGGCATCCGCGAGTTCGTCGAGTATCTGAACGAGACAAAGGACCCGCTCCACCGCGACATCATCTACTTCGAGGACGAGGAGGAAATCGCTGAGGGGCCGGTTCAGGTCGAGATTGCCATGCAGGGGACCGACGACCTGCAGGGCTCTATTCACGCCTTCGCCAACAATATCAACACGCGCGAGGGCGGGACACACCTCACAGGGTTCAAAACATCGCTCACACGGGTCGTCAACGACTACGCGACCGACAATAATCTGCTGAAAGACCTAGACGATACGCTCAAAGGCGACGACATCCGCGAAGGGCTGACAGCCGTCATTTCTGTCAAACATCCCGACCCCCAGTTCGAGGGCCAGACCAAGACGAAACTCGGCAACAGCGAGGTCCGGGGTATCGTCGAATCGGCGATGCACGACGGGCTTGCTACCTTCTTCGAGGAGAACCCCGACACGGCCGAGGCCATCGTCGGAAAGGCCGTCGAAGCCGCGAAAGCACGGAAGGCCGCACAGAAGGCAGAGGAACTCACCCGCCGGAAGTCGGCGCTCGACTCGACCGCACTGCCCGGAAAGCTGGCCGACTGCCAGACCCGGGACCCCGAGGAAGCCGAACTGTTCATCGCCGAGGGTGACTCCGCGGGCGGCAGCGCCAAACAGGGCCGCAACCCGGATTTCCAGGCCATCCTCCCCATCAAGGGGAAGATTCTGAACGTCGAGAAACACCGGCTAGACCGGATCTTGGAGAACAACGAGATACGGAACCTCATCACCGCGCTCGGGACCGGTATCGGCGACGAGTTCGATATCGACGACCTGCGTTACGAGAAGATCATTCTGATGACGGACGCGGACGTCGACGGGGCACACATCCGGACGCTCCTGTTGACGCTGTTCTACCGGCACATGAAGCCGCTGCTGGAAGCCGGCTACGTCTACGCCTCCCAGCCGCCGCTGTACCGCATTCGCTACCGCGGAAACACGTACGATGCAATGACGGATGCAGAACGCGACAAGATAATCGAAGAGAAGTGTGACGGCAACCCCACCCACGTCCAGCGGTTCAAGGGACTCGGTGAGATGAACCCCGAACAGCTCTGGGAGACGACGATGAACCCCGACAACCGGATTCTCAAACAGATAACTATCGAGGACGCCGCGGCCGCCGACAAGATGTTCAACATTCTGATGGGCGACGCCGTCGAACCTCGCAAGGAATTCATCAAGGAGAACTCGCCTGAAGCGGAGTGGGTCGACATATGA
pI4.4268
MW (k)71477.7
Translation (641 aa, Edit)MSGESDEYGAKSIQTLEGLEAVQKRPAMYIGSTDARGLHHLVYEVVDNAIDEALAGYCDNIDVTIHDDGSVSVSDDGRGIPVDTHEEHGRPAVEVVMTILHAGGKFDNKSYQVSGGLHGVGVSVVNALSKWLEVEVRRDGALWKQRFDHGKPEYDLKKVRDLEPDEETGTTVRFWPDDEIFETGEFKFSTLSSRLRELAFLNSGVAISIIDERDGETETFAYDGGIREFVEYLNETKDPLHRDIIYFEDEEEIAEGPVQVEIAMQGTDDLQGSIHAFANNINTREGGTHLTGFKTSLTRVVNDYATDNNLLKDLDDTLKGDDIREGLTAVISVKHPDPQFEGQTKTKLGNSEVRGIVESAMHDGLATFFEENPDTAEAIVGKAVEAAKARKAAQKAEELTRRKSALDSTALPGKLADCQTRDPEEAELFIAEGDSAGGSAKQGRNPDFQAILPIKGKILNVEKHRLDRILENNEIRNLITALGTGIGDEFDIDDLRYEKIILMTDADVDGAHIRTLLLTLFYRHMKPLLEAGYVYASQPPLYRIRYRGNTYDAMTDAERDKIIEEKCDGNPTHVQRFKGLGEMNPEQLWETTMNPDNRILKQITIEDAAAADKMFNILMGDAVEPRKEFIKENSPEAEWVDI