Gene ID799
Gene NameHAH_0799
Annotationhypothetical protein
LocationI:757819←758931
Gene typeHypothetical gene
GC content65
Hydropathicity0.777567567567569
DNA (1113 bp, Edit)ATGGAGCGACGGTGGCGAATCCTCGGCGGTTGTGGCCTTATCGCTGGTATCTTCCTGTTCGTCCAACTCGGCGCGCTGGCGCTGGTCCAGCCCTTCGAATCGGCTGGGTACCAGGCCGTCGAAGACCCGTCTGACCCCACGAACAGCCTCATGTACGTCGGGGCGATTCTGGTCGCAACGGCAGTTATGTTGCTTGCCTTCCGCTACGACGTTGACCAGCTCATTCGCGGGCTCATCGTCTTCTCGTCGGCCTGGCTCTCCCTGTACGTGTTTCAGGTGCTGGTCCCGCCGGTGCTCACGTACGCCGGCCTCAACGTCGTTGCCGTCCTGTTGGCGCTGGGCCTGGGGACGGCACTGCTGGTCTATCCCGAGTGGTACGTCATCGACGCCGCCGGTGCGGTGATGGGTGCTGCCGCAGCCGGCCTGTTTGGCATCAGTTTCGGGGTGTTGCCAGCGCTCGTCCTGCTGACTGTACTCGCCGTGTACGATGCGATCAGCGTCTACGGGACTGAGCACATGCTCACGCTGGCCTCGGGCGTCATGGACCTCAAGGTCCCCGTCGTCCTCGTGATCCCGATGACGCTGTCGTACTCCTATCTCGACGCAACGGCGGCGGATTCGGTAGCAGAAGACGAGACTGACGACGACGCAACGGCGGCGGACGACGCGGCCGAGGAGCCGGCGACCACAGAACACGGAGCCGACGCGGACGGTCCGGCGGTTGCGGATGGGAGCCAGCCGGCGGAGCGTCCCGACGACGCGACAGAGACTGGCAAAGCAGACGGAACTGCTGACGTTCACGCCGACCCGCTAGAGCGCGACGCGCTGTTTATCGGTCTCGGTGACGCCATCATCCCGTCGATACTCGTCGCCAGCGCCGCCTTTTTCGCCTCGTCGGACGTACTGTCAGTGTTCGGCGTCCCGTTGCCGGCGCTGACCGCGATGCTCGGGTCCTACGTCGGCCTGGCGATACTGCTGTGGATGGTGCTGAAGGGGCGCGCACACGCAGGACTCCCGCTCTTGAACGGTGGAACCATCGCCGGCTACATCGTCGGCGCACTCGCCGCCGGTATTAGTCTGATAGACGCCCTCGGTCTCGGCCCGTACCTCTAA
pI3.759
MW (k)38100.1
Translation (369 aa, Edit)MERRWRILGGCGLIAGIFLFVQLGALALVQPFESAGYQAVEDPSDPTNSLMYVGAILVATAVMLLAFRYDVDQLIRGLIVFSSAWLSLYVFQVLVPPVLTYAGLNVVAVLLALGLGTALLVYPEWYVIDAAGAVMGAAAAGLFGISFGVLPALVLLTVLAVYDAISVYGTEHMLTLASGVMDLKVPVVLVIPMTLSYSYLDATAADSVAEDETDDDATAADDAAEEPATTEHGADADGPAVADGSQPAERPDDATETGKADGTADVHADPLERDALFIGLGDAIIPSILVASAAFFASSDVLSVFGVPLPALTAMLGSYVGLAILLWMVLKGRAHAGLPLLNGGTIAGYIVGALAAGISLIDALGLGPYL