Gene ID579
Gene NamednaK1
Annotationchaperone protein DnaK
LocationI:542159←544063
Gene typeFunctional gene
GC content65
Hydropathicity-0.586119873817034
DNA (1905 bp, Edit)ATGGCGAGCAACAAGATTCTGGGTATCGACCTTGGGACCACGAACAGCGCGTTCGCGGTCATGGAAGGTGGCGACCCCGAAATCATTGTCAACGGCGAAGGCGAGCGGACGACACCCTCTGTCGTCGCGTTCGACGACGGCGAGCGACTCGTCGGGAAACCGGCGAAGAACCAGGCGGTAAAGAACCCCGACGAGACCATCCAGTCGATCAAGCGCCACATGGGCGAGGACGACTACTCGGTCGAACTGGACGGGGAGGAGTACACGCCGGAGCAGGTCTCGGCGATGATCTTGCAGAAGATCAAACACGACGCCGAGGAGTACCTCGGCGACGAGATCGAGAAGGCCGTCATTACCGTCCCGGCGTACTTCAACGACCGACAGCGCCAGGCGACCAAGGACGCCGGGGAGATCGCCGGCTTCGAGGTCGAGCGCATCGTCAACGAGCCGACCGCGGCCGCGATGGCCTACGGCCTCGACGACGAGTCCGACCAGACCGTCCTCGTGTACGACCTCGGGGGCGGCACCTTCGACGTCTCCATCCTCGATCTCGGTGGGGGCGTCTACGAGGTTGTCGCCACGAACGGGGACAACGACCTCGGTGGCGACGACTGGGACCACGCCATCATCGACTACCTCGCAGACGAGTTCGAGGCTGAACACGGCATCGACCTGCGCGACGACCGGCAGGCCCTCCAGCGGCTGACCGAAGCCGCCGAGGAAGCCAAGATAGAACTCTCCTCGCGCAAGGAAACTCGCATCAACCTCCCGTTCATCGCGACCACGGACGACGGGCCGCTGGACCTCGAACAGAAGGTCACGCGCGCGAAGTTCGAGTCCCTTACCGAGGACCTCATCGAGCGCACCGTCGGGCCGACGGAGCAGGCGCTTGCTGACGCGGACTACACAAAGAGCGACATCGACGAGGTCATCCTCGTCGGCGGTTCGACGCGGATGCCCCAGGTGCAAGACCAGGTCGAAGAGATGACTGGGCAGGAGCCGAAGAAGAACGTCAACCCCGACGAGGCCGTCGCGCTGGGCGCGGCCATTCAGGCCGGCGTCCTCTCGGGCGACGTGGACGACATCGTCCTGCTCGACGTGACGCCGCTATCGCTGGGTGTCGAGGTCAAGGGTGGTCTGTTCGAGCGGCTCATCGACAAGAACACGACCATCCCGACCGAGGAATCGAAGATCTTCACGACCGCCCAAGACAACCAGACGCAGGTCCAGATCCGCGTCTTCCAGGGCGAGCGTGAGATCGCCGAGGAGAACGAACTGCTCGGCGCGTTCGCGCTCTCCGGCATCCCGCCAGCCCCCGCGGGCACGCCCCAGATCGAGGTGTCGTTCAACATCGACGAGAACGGTATCGTCAACGTCGAAGCCGAAGACAAGGGCTCGGGCAACAAGGAGGACATCACCATCGAGGGCGGTGCCGGACTCTCCGACGAACAGATCGAGGAGATGCAACAGGAGGCCGAACAGCACGCCGAAGAAGACGAGCAGCGCCGCGAGCGCATCGAGGCCCGCAACGAGGCCGAGGCCTCGGTCCGCCGTGCCGAGACGCTCCTCGACGAGAACGAGGAGGAGATCGACGAGGACCTCCAGTCCGACATCGAGGCGAAAATCGAGGACGTCGAGGAAGTCCTCGAAGACGAGGACGCCACGAAGGAAGACTACGAGGAGGTCACCGAAACCCTGAGCGAGGAACTGCAGGAGATCGGCAAGCAGATGTACCAGGACCAGGCCCAGCAGGCCGCCGGCGGTGCCGCGGGCGCTGGTCCGGGCGGCGCAGCCGGGGCCGGCGGAGCCGCTGGGCCAGGTGGCGCAGCAGGCGGCGCTGCAGAGCAGGGCGAGGAGTACGTCGACGCCGACTTCGAAGACGTCGACGACGAGGACGAGGACTAA
pI3.7173
MW (k)68448.2
Translation (633 aa, Edit)MASNKILGIDLGTTNSAFAVMEGGDPEIIVNGEGERTTPSVVAFDDGERLVGKPAKNQAVKNPDETIQSIKRHMGEDDYSVELDGEEYTPEQVSAMILQKIKHDAEEYLGDEIEKAVITVPAYFNDRQRQATKDAGEIAGFEVERIVNEPTAAAMAYGLDDESDQTVLVYDLGGGTFDVSILDLGGGVYEVVATNGDNDLGGDDWDHAIIDYLADEFEAEHGIDLRDDRQALQRLTEAAEEAKIELSSRKETRINLPFIATTDDGPLDLEQKVTRAKFESLTEDLIERTVGPTEQALADADYTKSDIDEVILVGGSTRMPQVQDQVEEMTGQEPKKNVNPDEAVALGAAIQAGVLSGDVDDIVLLDVTPLSLGVEVKGGLFERLIDKNTTIPTEESKIFTTAQDNQTQVQIRVFQGEREIAEENELLGAFALSGIPPAPAGTPQIEVSFNIDENGIVNVEAEDKGSGNKEDITIEGGAGLSDEQIEEMQQEAEQHAEEDEQRRERIEARNEAEASVRRAETLLDENEEEIDEDLQSDIEAKIEDVEEVLEDEDATKEDYEEVTETLSEELQEIGKQMYQDQAQQAAGGAAGAGPGGAAGAGGAAGPGGAAGGAAEQGEEYVDADFEDVDDEDED